ID: 1200959860_1200959864

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1200959860 1200959864
Species Human (GRCh38) Human (GRCh38)
Location Y:8986733-8986755 Y:8986754-8986776
Sequence CCTCTGTTTATGTTGCCACTCCC CCATTCCCACAAAAAAAACTAGG
Strand - +
Off-target summary {0: 2, 1: 4, 2: 17, 3: 26, 4: 186} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!