ID: 1201066966_1201066970

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1201066966 1201066970
Species Human (GRCh38) Human (GRCh38)
Location Y:10106235-10106257 Y:10106251-10106273
Sequence CCAGTGAATTTGGGAGAGGGAGG AGGGAGGGCACAGTGACTGGAGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 6, 3: 44, 4: 564} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!