ID: 1201160470_1201160475

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1201160470 1201160475
Species Human (GRCh38) Human (GRCh38)
Location Y:11161063-11161085 Y:11161080-11161102
Sequence CCAGCTGCAAAATCCCAAAGCCC AAGCCCCCAGCCCTCTCATGGGG
Strand - +
Off-target summary No data {0: 5, 1: 2, 2: 1, 3: 19, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!