ID: 1201251268_1201251274

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1201251268 1201251274
Species Human (GRCh38) Human (GRCh38)
Location Y:12060491-12060513 Y:12060537-12060559
Sequence CCTGGACACATACACCCTGCCAA TATCTGAACAGATCAATAGCAGG
Strand - +
Off-target summary {0: 25, 1: 2750, 2: 4665, 3: 5983, 4: 3528} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!