ID: 1201251270_1201251275

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1201251270 1201251275
Species Human (GRCh38) Human (GRCh38)
Location Y:12060505-12060527 Y:12060551-12060573
Sequence CCCTGCCAATACTAAACCAGGAA AATAGCAGGCTCTGAAATTGAGG
Strand - +
Off-target summary No data {0: 68, 1: 4307, 2: 3735, 3: 4133, 4: 2042}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!