ID: 1201251273_1201251274

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1201251273 1201251274
Species Human (GRCh38) Human (GRCh38)
Location Y:12060521-12060543 Y:12060537-12060559
Sequence CCAGGAAGAAGTTGAATATCTGA TATCTGAACAGATCAATAGCAGG
Strand - +
Off-target summary {0: 43, 1: 5910, 2: 3595, 3: 2439, 4: 2576} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!