ID: 1201361319_1201361326

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1201361319 1201361326
Species Human (GRCh38) Human (GRCh38)
Location Y:13153069-13153091 Y:13153098-13153120
Sequence CCAGCTACCTTCACCTCTCACTG CAGGGATGAGCCACTGCACCTGG
Strand - +
Off-target summary No data {0: 39, 1: 7224, 2: 33674, 3: 84011, 4: 145530}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!