ID: 1201419457_1201419463

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1201419457 1201419463
Species Human (GRCh38) Human (GRCh38)
Location Y:13782446-13782468 Y:13782494-13782516
Sequence CCTCCTTGAGCTGCAGTGGGCTC TTTGTTTACCTACTCAAGCCTGG
Strand - +
Off-target summary {0: 307, 1: 591, 2: 3701, 3: 1447, 4: 857} {0: 86, 1: 551, 2: 2132, 3: 545, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!