ID: 1201419460_1201419463

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1201419460 1201419463
Species Human (GRCh38) Human (GRCh38)
Location Y:13782471-13782493 Y:13782494-13782516
Sequence CCCAGTTTGAACTTCCTTGCTGC TTTGTTTACCTACTCAAGCCTGG
Strand - +
Off-target summary No data {0: 86, 1: 551, 2: 2132, 3: 545, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!