ID: 1201419460_1201419468

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1201419460 1201419468
Species Human (GRCh38) Human (GRCh38)
Location Y:13782471-13782493 Y:13782505-13782527
Sequence CCCAGTTTGAACTTCCTTGCTGC ACTCAAGCCTGGGCAATGGCGGG
Strand - +
Off-target summary No data {0: 59, 1: 785, 2: 2481, 3: 1672, 4: 3692}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!