ID: 1201419462_1201419465

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1201419462 1201419465
Species Human (GRCh38) Human (GRCh38)
Location Y:13782485-13782507 Y:13782501-13782523
Sequence CCTTGCTGCTTTGTTTACCTACT ACCTACTCAAGCCTGGGCAATGG
Strand - +
Off-target summary {0: 24, 1: 720, 2: 1518, 3: 3230, 4: 1229} {0: 78, 1: 970, 2: 3739, 3: 2049, 4: 1722}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!