ID: 1201440218_1201440224

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1201440218 1201440224
Species Human (GRCh38) Human (GRCh38)
Location Y:14000682-14000704 Y:14000716-14000738
Sequence CCTGTTTCAGAGAGCACGGGGTT CATAGATTAACAGCATCCCAAGG
Strand - +
Off-target summary No data {0: 31, 1: 644, 2: 459, 3: 1481, 4: 453}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!