ID: 1201530470_1201530477

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1201530470 1201530477
Species Human (GRCh38) Human (GRCh38)
Location Y:14985566-14985588 Y:14985595-14985617
Sequence CCTCCTCTAATCTCCCCCACACA AACAAGCAAAGAAATCTCCATGG
Strand - +
Off-target summary No data {0: 28, 1: 29, 2: 14, 3: 53, 4: 491}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!