ID: 1201571651_1201571655

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1201571651 1201571655
Species Human (GRCh38) Human (GRCh38)
Location Y:15421796-15421818 Y:15421836-15421858
Sequence CCTTATTCAAAAACACTGACCTT GGGCCACAGAACTTCTGTGAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 22, 4: 289} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!