ID: 1201648868_1201648875

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1201648868 1201648875
Species Human (GRCh38) Human (GRCh38)
Location Y:16264079-16264101 Y:16264116-16264138
Sequence CCTCCAGATTTTGTTCAGGTCCC GAGCTTTCTCCTGATATCTGTGG
Strand - +
Off-target summary No data {0: 75, 1: 53, 2: 28, 3: 36, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!