ID: 1201898918_1201898921

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1201898918 1201898921
Species Human (GRCh38) Human (GRCh38)
Location Y:19026069-19026091 Y:19026104-19026126
Sequence CCCACTTTTGGATGGGTTTGTTT TTTAAGTTGTTGGTAGCTTCTGG
Strand - +
Off-target summary {0: 4, 1: 329, 2: 14643, 3: 9902, 4: 6808} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!