ID: 1201904603_1201904619

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1201904603 1201904619
Species Human (GRCh38) Human (GRCh38)
Location Y:19076680-19076702 Y:19076721-19076743
Sequence CCGGGCTCCCAGAACCCCCAGGC TCGGTCCCCCACAGCCCCCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 13, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!