ID: 1201913876_1201913879

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1201913876 1201913879
Species Human (GRCh38) Human (GRCh38)
Location Y:19161507-19161529 Y:19161540-19161562
Sequence CCTACCAACTAAAAAGTTCATAA TCACAGCTGAATTCTACCAAAGG
Strand - +
Off-target summary No data {0: 34, 1: 1777, 2: 6485, 3: 4149, 4: 1753}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!