ID: 1201920563_1201920564

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1201920563 1201920564
Species Human (GRCh38) Human (GRCh38)
Location Y:19229342-19229364 Y:19229357-19229379
Sequence CCAGCAAGCTGCAATAGCACCAC AGCACCACTGTATTCCAGCCTGG
Strand - +
Off-target summary No data {0: 13, 1: 459, 2: 9352, 3: 72250, 4: 166875}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!