ID: 1201920563_1201920565

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1201920563 1201920565
Species Human (GRCh38) Human (GRCh38)
Location Y:19229342-19229364 Y:19229358-19229380
Sequence CCAGCAAGCTGCAATAGCACCAC GCACCACTGTATTCCAGCCTGGG
Strand - +
Off-target summary No data {0: 163, 1: 6372, 2: 62719, 3: 152888, 4: 214905}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!