ID: 1202056323_1202056335

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1202056323 1202056335
Species Human (GRCh38) Human (GRCh38)
Location Y:20835282-20835304 Y:20835335-20835357
Sequence CCTGTGTTCTCACTTATAAGTGG AAGGTTATAATGAACTCTGGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!