ID: 1202116816_1202116818

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1202116816 1202116818
Species Human (GRCh38) Human (GRCh38)
Location Y:21476758-21476780 Y:21476784-21476806
Sequence CCATGCATGGTCTGAGTATGCTT GCAGTCTCCTCCCTGAGCCTTGG
Strand - +
Off-target summary No data {0: 14, 1: 1, 2: 22, 3: 48, 4: 437}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!