ID: 1202134541_1202134544

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1202134541 1202134544
Species Human (GRCh38) Human (GRCh38)
Location Y:21648071-21648093 Y:21648103-21648125
Sequence CCAGTAACAGGCCAAGATCTCTC GTAGTTATTTGCAGAACATGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 15, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!