ID: 1202260716_1202260719

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1202260716 1202260719
Species Human (GRCh38) Human (GRCh38)
Location Y:22967432-22967454 Y:22967477-22967499
Sequence CCCTGCTTCCACTGGGGATTATA AATGATATGACTCTCTTGCCTGG
Strand - +
Off-target summary No data {0: 10, 1: 17, 2: 34, 3: 84, 4: 300}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!