ID: 1202367283_1202367288

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1202367283 1202367288
Species Human (GRCh38) Human (GRCh38)
Location Y:24174091-24174113 Y:24174111-24174133
Sequence CCTGTGTACCGCTCTAGGAGCCC CCCTGATCCCACAGGAGCTTGGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 2, 3: 21, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!