ID: 1202379032_1202379049

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1202379032 1202379049
Species Human (GRCh38) Human (GRCh38)
Location Y:24260554-24260576 Y:24260607-24260629
Sequence CCCCCACCCCCATCTGCAGGCCC GGACCAGGCCAGCCTCCCTGCGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 12, 3: 50, 4: 375}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!