ID: 1202445100_1202445109

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1202445100 1202445109
Species Human (GRCh38) Human (GRCh38)
Location Y:24950249-24950271 Y:24950272-24950294
Sequence CCGGCGCTTGCGGGCCCGCTTGA GTTCCGGGTGGGTGTGGGCTTGG
Strand - +
Off-target summary No data {0: 63, 1: 709, 2: 625, 3: 344, 4: 428}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!