ID: 1202491742_1202491755

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1202491742 1202491755
Species Human (GRCh38) Human (GRCh38)
Location Y:25409555-25409577 Y:25409592-25409614
Sequence CCTGAGTCATGTGGGCCTGCAGA TCCCTTCCAGGGCCCTGAGTGGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 1, 3: 22, 4: 188} {0: 3, 1: 0, 2: 3, 3: 24, 4: 246}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!