ID: 1202567557_1202567558

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1202567557 1202567558
Species Human (GRCh38) Human (GRCh38)
Location Y:26230017-26230039 Y:26230066-26230088
Sequence CCTAATTAGTTTGTAGGACTGGT GTTCCCTTTATGCACATTAATGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 1, 4: 80} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!