ID: 1202704896_1202704903

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1202704896 1202704903
Species Human (GRCh38) Human (GRCh38)
Location 1_KI270713v1_random:15253-15275 1_KI270713v1_random:15290-15312
Sequence CCGGTGCCGGGCAGCGGTGGGTG CCCACAGCGCCCCCAGCCCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!