ID: 1202858189_1202858199

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1202858189 1202858199
Species Human (GRCh38) Human (GRCh38)
Location 14_GL000225v1_random:64260-64282 14_GL000225v1_random:64280-64302
Sequence CCCTGTGCCGGGGCAGCCTTGCT GCTGGGCTGGAGCACGGGGACGG
Strand - +
Off-target summary No data {0: 10, 1: 10, 2: 13, 3: 69, 4: 604}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!