ID: 1202872644_1202872659

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1202872644 1202872659
Species Human (GRCh38) Human (GRCh38)
Location 14_GL000225v1_random:177957-177979 14_GL000225v1_random:177979-178001
Sequence CCAGGGGCTCCCTCCGAGCCCGG GGCATGGGCCGGGCCTGGGGTGG
Strand - +
Off-target summary No data {0: 3, 1: 1, 2: 8, 3: 138, 4: 1092}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!