ID: 1203032243_1203032245

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1203032243 1203032245
Species Human (GRCh38) Human (GRCh38)
Location 16_KI270728v1_random:604628-604650 16_KI270728v1_random:604655-604677
Sequence CCTATCACAAAGTTATTTCTCAG CTTCCTGCTAATTTTTATCTAGG
Strand - +
Off-target summary No data {0: 4, 1: 3, 2: 159, 3: 1209, 4: 2404}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!