ID: 1203034554_1203034560

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1203034554 1203034560
Species Human (GRCh38) Human (GRCh38)
Location 16_KI270728v1_random:628447-628469 16_KI270728v1_random:628465-628487
Sequence CCCGCCAGCCTACACTGCCAGCC CAGCCGCCACCTGACCACACGGG
Strand - +
Off-target summary {0: 5, 1: 3, 2: 2, 3: 48, 4: 541} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!