ID: 1203034558_1203034566

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1203034558 1203034566
Species Human (GRCh38) Human (GRCh38)
Location 16_KI270728v1_random:628464-628486 16_KI270728v1_random:628484-628506
Sequence CCAGCCGCCACCTGACCACACGG CGGGCCTCTGCTTGCTAGCCGGG
Strand - +
Off-target summary No data {0: 3, 1: 1, 2: 2, 3: 33, 4: 684}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!