ID: 1203065411_1203065416

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1203065411 1203065416
Species Human (GRCh38) Human (GRCh38)
Location 16_KI270728v1_random:1012784-1012806 16_KI270728v1_random:1012806-1012828
Sequence CCCTCTGCTGTCTGGTTAGCAGG GAGGTACAATTTGTACAGGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!