ID: 1203071546_1203071549

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1203071546 1203071549
Species Human (GRCh38) Human (GRCh38)
Location 16_KI270728v1_random:1081084-1081106 16_KI270728v1_random:1081106-1081128
Sequence CCAGGATGGTCTCGATCTCCTGG GCCTTGTAATACGCCCGCCTTGG
Strand - +
Off-target summary {0: 389, 1: 53730, 2: 75466, 3: 152867, 4: 231362} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!