ID: 1203078609_1203078615

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1203078609 1203078615
Species Human (GRCh38) Human (GRCh38)
Location 16_KI270728v1_random:1135190-1135212 16_KI270728v1_random:1135217-1135239
Sequence CCTTTCCAGGCTACAGTAGTTGG ATGGACAAGAAGAAAGAGTAAGG
Strand - +
Off-target summary No data {0: 3, 1: 1, 2: 3, 3: 60, 4: 712}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!