ID: 1203143165_1203143170

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1203143165 1203143170
Species Human (GRCh38) Human (GRCh38)
Location 16_KI270728v1_random:1782209-1782231 16_KI270728v1_random:1782250-1782272
Sequence CCCAGATGGAGGACACTGAGTGT GTGGATCCCCAGATGGAGTATGG
Strand - +
Off-target summary {0: 2, 1: 23, 2: 20, 3: 18, 4: 162} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!