ID: 1203165192_1203165194

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1203165192 1203165194
Species Human (GRCh38) Human (GRCh38)
Location 17_GL000205v2_random:87252-87274 17_GL000205v2_random:87281-87303
Sequence CCTGAGCTGGGTGCATGCTGGGA TCCTGCAGCCCGGTGATGAAAGG
Strand - +
Off-target summary {0: 4, 1: 14, 2: 18, 3: 46, 4: 312} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!