ID: 1203223653_1203223660

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1203223653 1203223660
Species Human (GRCh38) Human (GRCh38)
Location 22_KI270731v1_random:63874-63896 22_KI270731v1_random:63890-63912
Sequence CCTGACCTGCCTCCAGCCTTCTT CCTTCTTTGCAGGAGATGGATGG
Strand - +
Off-target summary No data {0: 7, 1: 1, 2: 3, 3: 28, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!