ID: 1203446753_1203446757

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1203446753 1203446757
Species Human (GRCh38) Human (GRCh38)
Location Un_GL000219v1:63862-63884 Un_GL000219v1:63903-63925
Sequence CCTTCACTCTTCTAGAAGGACTT TCCATGGTTTAGAATAAAAGAGG
Strand - +
Off-target summary No data {0: 17, 1: 21, 2: 24, 3: 47, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!