ID: 900094915_900094933

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 900094915 900094933
Species Human (GRCh38) Human (GRCh38)
Location 1:936389-936411 1:936428-936450
Sequence CCGGTCCCGCCTCCTAGGGCTCC CCGGTCGGTCCCGCCTTCTAGGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 1, 3: 15, 4: 251} {0: 1, 1: 0, 2: 0, 3: 0, 4: 18}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!