ID: 900106220_900106236

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 900106220 900106236
Species Human (GRCh38) Human (GRCh38)
Location 1:982238-982260 1:982283-982305
Sequence CCCTCCAGCTACAGTACATGAGG GGCTGAGGTGGGGTCAGACACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 108} {0: 1, 1: 5, 2: 30, 3: 47, 4: 508}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!