ID: 900119924_900119944

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 900119924 900119944
Species Human (GRCh38) Human (GRCh38)
Location 1:1044236-1044258 1:1044285-1044307
Sequence CCAGAGTGTCCCAGGCAGCCCGG GGGCGGCGGGGACGGGGCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 276} {0: 1, 1: 0, 2: 34, 3: 259, 4: 1834}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!