ID: 900155889_900155893

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 900155889 900155893
Species Human (GRCh38) Human (GRCh38)
Location 1:1203139-1203161 1:1203153-1203175
Sequence CCGAGGGTGGGATGGTGAGGAGA GTGAGGAGAGAGGGCTGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 14, 2: 14, 3: 31, 4: 344} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!