ID: 900191884_900191897

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 900191884 900191897
Species Human (GRCh38) Human (GRCh38)
Location 1:1355558-1355580 1:1355597-1355619
Sequence CCAGCAGGCGCCGCGCGGGGCCA GGTCCCAGTGGAGCACGCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 316} {0: 1, 1: 0, 2: 0, 3: 8, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!