ID: 900206017_900206025

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 900206017 900206025
Species Human (GRCh38) Human (GRCh38)
Location 1:1432212-1432234 1:1432245-1432267
Sequence CCCTTTCAGGGAAGGATGTCCCA AAAGTGAGGGGACCCACACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 154} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!