ID: 900236588_900236593

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 900236588 900236593
Species Human (GRCh38) Human (GRCh38)
Location 1:1594479-1594501 1:1594497-1594519
Sequence CCAGGGGTCTCAGCAGGTTCCGG TCCGGCTGGGACGCGGCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 163} {0: 1, 1: 0, 2: 1, 3: 10, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!