ID: 900261038_900261042

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 900261038 900261042
Species Human (GRCh38) Human (GRCh38)
Location 1:1729658-1729680 1:1729695-1729717
Sequence CCTGAGCTACCGCAGCCGGTCTT GGAAAGCAGAAAAAAAGAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 242} {0: 2, 1: 6, 2: 81, 3: 885, 4: 4793}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!